circad | circRNAs associated with diseases

hsa_circ_0001313/circCCDC66
Gene	CCDC66	Organism	Human
Genome Locus	chr3:56626997-56628056:+	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	28249903
Experimental Method
Sample Type	Tissues	Comparison	12 paired tumor/adjacent non-tumor specimens
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCTCTTGGACCCAGCTCAG Reverse TGAATCAAAGTGCATTGCCC	Statistics	Fold Change : Upregulated,> 1.5 pvalue : p<0.05
Citation
Hsiao, KY, Lin, YC, Gupta, SK, Chang, N, Yen, L, Sun, HS, Tsai, SJ (2017). Noncoding Effects of Circular RNA CCDC66 Promote Colon Cancer Growth and Metastasis. Cancer Res., 77, 9:2339-2350.